View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8584_high_7 (Length: 252)
Name: NF8584_high_7
Description: NF8584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8584_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 19411818 - 19412029
Alignment:
| Q |
1 |
attgtgacaattggaggtagttgttcccattcagtttatgtcctgtaatggggagatgggtggtggcctccaaggttacaccatgattggtgctgacttg |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19411818 |
attgtgaccattggaggtagttgttcccattcagtttgtgtcctgtaatggggagatgggtcgtggcctccaaggttacaccatgattggtgctgactta |
19411917 |
T |
|
| Q |
101 |
ttgtgaagagggtcgattgtcatcctctttgagtatggaggtttctttttctgtagccataccgtatttggtcatggtaaggaccggtttgctactgata |
200 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19411918 |
ttgtgaagaggattgattgtcatcctctttgagtatggaggtttctttttctgtagccataccgtatttggtcatggtaaggaccggtttgctactgata |
19412017 |
T |
|
| Q |
201 |
ccatgtagaaat |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
19412018 |
ccatgtagaaat |
19412029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 203 - 236
Target Start/End: Original strand, 19407277 - 19407310
Alignment:
| Q |
203 |
atgtagaaattcagagaatatatattttgtattt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
19407277 |
atgtagaaattcagagaatatatattttgtattt |
19407310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University