View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8584_high_8 (Length: 250)
Name: NF8584_high_8
Description: NF8584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8584_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 46259791 - 46259558
Alignment:
| Q |
1 |
gtttcacgcggcggtcgattttcgattgtatggtggctggttcgataccggnnnnnnnctggcggcgaacggcgtatttacagtatcagtggtttttacc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46259791 |
gtttcacgcggcggtcgattttcgattgtatggtggctggttccataccggtttttttctggcggcgaacggcgtatttacagtatcagtggtttttacc |
46259692 |
T |
|
| Q |
101 |
ggaagtaccggagagttactcggtttatattgaccggaacgcggttaaaaacgggacatccgtgaaagcggtgcttgagagtttcacgaaagaagaggtt |
200 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46259691 |
ggaagaaccggggagttactcggtttatattgaccggaacgcggttaaaaacgggacatccgtgaaagcggtgcttgagagtttcacgaaagaagaggtt |
46259592 |
T |
|
| Q |
201 |
aggaaaatgagggagaaagtgattgagtatattc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
46259591 |
aggaaaatgagggagaaagtgattgagtatattc |
46259558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University