View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8584_low_13 (Length: 317)
Name: NF8584_low_13
Description: NF8584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8584_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 62 - 298
Target Start/End: Original strand, 43924247 - 43924483
Alignment:
| Q |
62 |
ggtgttggcgtgtcctttgttccgttcgtcagtctaagctaactaactttgaactaatcataaatcacgtgcaacaatattgaactaattcttctaacat |
161 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||||||||||||| |
|
|
| T |
43924247 |
ggtgtaggcgtgtcctttgttccgttcatcagtctaagctaactaactttgaactaatcataactaacgtggaacaatattgaactaattcttctaacat |
43924346 |
T |
|
| Q |
162 |
gaacatctgaactagaagtttataaaaattagagaggaatgaatacctgggaagcattggttgggagtaaccaatgagggggaacacgaaggtcttgaac |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43924347 |
gaacatctgaactagaagtttataaaaattagagaggaatgaatacctgggaagcattggttgggagtaaccaatgagggggaacacgaaggtcttgaac |
43924446 |
T |
|
| Q |
262 |
ttggtagtcatcgggttctgggaatgaacgagaatgt |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43924447 |
ttggtagtcatcgggttctgggaatgaacgagaatgt |
43924483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University