View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8584_low_18 (Length: 250)

Name: NF8584_low_18
Description: NF8584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8584_low_18
NF8584_low_18
[»] chr1 (1 HSPs)
chr1 (1-234)||(46259558-46259791)


Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 46259791 - 46259558
Alignment:
1 gtttcacgcggcggtcgattttcgattgtatggtggctggttcgataccggnnnnnnnctggcggcgaacggcgtatttacagtatcagtggtttttacc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||       ||||||||||||||||||||||||||||||||||||||||||    
46259791 gtttcacgcggcggtcgattttcgattgtatggtggctggttccataccggtttttttctggcggcgaacggcgtatttacagtatcagtggtttttacc 46259692  T
101 ggaagtaccggagagttactcggtttatattgaccggaacgcggttaaaaacgggacatccgtgaaagcggtgcttgagagtttcacgaaagaagaggtt 200  Q
    ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46259691 ggaagaaccggggagttactcggtttatattgaccggaacgcggttaaaaacgggacatccgtgaaagcggtgcttgagagtttcacgaaagaagaggtt 46259592  T
201 aggaaaatgagggagaaagtgattgagtatattc 234  Q
    ||||||||||||||||||||||||||||||||||    
46259591 aggaaaatgagggagaaagtgattgagtatattc 46259558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University