View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8585_low_5 (Length: 258)
Name: NF8585_low_5
Description: NF8585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8585_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 146; Significance: 5e-77; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 9988066 - 9987909
Alignment:
| Q |
1 |
agatagacacataaagtgaagtcgattattcaaattcgataatattgtaggaaaatagcgggataaacttccttgttaggggctctctcgtaaatgaatg |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9988066 |
agataaacacataaagtgaagtcgattattcaaattcgataatattgtaggaaaatagcgggataaacttccttgttaagggctctctcgtaaatgaatg |
9987967 |
T |
 |
| Q |
101 |
taaacaaaccagttctcattttaatcatgttgtttttgctcatattagatgagaagtt |
158 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9987966 |
taaactaaccagttctcattttaatcatgttgtttttgctcatattagatgagaagtt |
9987909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 129 - 198
Target Start/End: Complemental strand, 9987911 - 9987842
Alignment:
| Q |
129 |
gttgtttttgctcatattagatgagaagttaatcaaacggctcattatttagctaagtttgcaattgata |
198 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9987911 |
gttgtttttgctcagattagatgagaagttaatcaaacggctcattatttagctaagtttgcaattgata |
9987842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 198 - 247
Target Start/End: Complemental strand, 9987816 - 9987767
Alignment:
| Q |
198 |
agaaactccttcttgtattgacacggttgtggcttttgatatgatgtcca |
247 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9987816 |
agaaactcctccttatattgacacggttgtggcttttgatatgatgtcca |
9987767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 139 - 193
Target Start/End: Original strand, 20781967 - 20782021
Alignment:
| Q |
139 |
ctcatattagatgagaagttaatcaaacggctcattatttagctaagtttgcaat |
193 |
Q |
| |
|
||||| ||||| |||||| ||||||| | |||||||||||||||||||||||||| |
|
|
| T |
20781967 |
ctcatgttagaagagaagctaatcaagctgctcattatttagctaagtttgcaat |
20782021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University