View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8585_low_6 (Length: 240)
Name: NF8585_low_6
Description: NF8585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8585_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 4e-65; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 17 - 150
Target Start/End: Complemental strand, 12176015 - 12175882
Alignment:
| Q |
17 |
tttattacatttcaagctacacttgacatgaagttttatttattgtgataggtatagtaacaagagcccattagctcgatttttagcttagtcatgaggt |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12176015 |
tttattacatttcaagctatacttgacatgaagttttatttattgtgataagtatagtaacaagagcccattagctcgatttttagcttagtcatgaggt |
12175916 |
T |
|
| Q |
117 |
tcagcatcaatatgagcatcattatgttcttttg |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
12175915 |
tcagcatcaatatgagcatcattatgttcttttg |
12175882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 35 - 148
Target Start/End: Complemental strand, 12189235 - 12189120
Alignment:
| Q |
35 |
acacttgacatgaagttttatttattgtgataggtatagtaacaagagccca--ttagctcgatttttagcttagtcatgaggttcagcatcaatatgag |
132 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| || ||||||||||||| ||||| |||| | ||||||| |||||||||| ||||| ||| | |
|
|
| T |
12189235 |
acacttcacatgaagttttatttattgtgatacatagtataacaagagcccactctagctaaatttcttgcttagttatgaggttcaacatcagtattgg |
12189136 |
T |
|
| Q |
133 |
catcattatgttcttt |
148 |
Q |
| |
|
||||| | |||||||| |
|
|
| T |
12189135 |
catcactgtgttcttt |
12189120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 17 - 125
Target Start/End: Complemental strand, 12183544 - 12183433
Alignment:
| Q |
17 |
tttattacatttcaagctacacttgacatgaagttttatttattgtgataggtatagt--aacaagagccca---ttagctcgatttttagcttagtcat |
111 |
Q |
| |
|
||||||||||||| | || || || |||||||||||||||||||||||| | ||||| |||||||| ||| |||||| |||| | ||||||| || |
|
|
| T |
12183544 |
tttattacatttctaacttcatttaacatgaagttttatttattgtgat--gcatagtacaacaagagaccactcttagctgaatttcttgcttagttat |
12183447 |
T |
|
| Q |
112 |
gaggttcagcatca |
125 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
12183446 |
gaggttcagcatca |
12183433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University