View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8586_high_13 (Length: 243)
Name: NF8586_high_13
Description: NF8586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8586_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 234
Target Start/End: Complemental strand, 38025706 - 38025491
Alignment:
| Q |
19 |
aaggtttccacgccgcctctcgcaagagcttctgcagcggaggatccagcgggtcctccgccaattactgctgctcggagcttgcggccggcgatcgatg |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38025706 |
aaggtttccacgccgccgctcgcaagagcttctgcagcggaggatccagcgggtcctccgccaattactgctgctcggagcttgcggccggcgatcgatg |
38025607 |
T |
 |
| Q |
119 |
gacgtgtcgaattcgaggcagaaatagtaattgtgtggaagtgttgtttgggttttgaagttggaactgagaatgagggtgaaaaggtttgaattttcaa |
218 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38025606 |
ggcgtgtcgaattcgaggcagaaatagtaattgagtggaagtgttgtttgggttttgaagttggaactgagaatgaaggtgaaaaggtttgaattttcaa |
38025507 |
T |
 |
| Q |
219 |
tgccatggagaataat |
234 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38025506 |
tgccatggagaataat |
38025491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University