View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8586_high_15 (Length: 233)
Name: NF8586_high_15
Description: NF8586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8586_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 5e-37; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 128 - 230
Target Start/End: Original strand, 7850646 - 7850748
Alignment:
| Q |
128 |
tacacggttcaagataaagaattcgatctccttactactctctcggcgtctccttttataggcgacactttcttgatctaacgggtctttcttttgatgt |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |||||||||||||||||||||||||| |||| |||| |
|
|
| T |
7850646 |
tacacggttcaagataaagaattcgatctccttactactctttcgttgtctccttttataggcaacactttcttgatctaacgggtctttttttttatgt |
7850745 |
T |
|
| Q |
228 |
cca |
230 |
Q |
| |
|
||| |
|
|
| T |
7850746 |
cca |
7850748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 70 - 124
Target Start/End: Original strand, 7850529 - 7850583
Alignment:
| Q |
70 |
tttcaccatgtgtcctgttgacgtatgtaaacccaagttaattacaataagtgag |
124 |
Q |
| |
|
|||| |||||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7850529 |
tttcgccatgtgttctgttgacgtatgtaaactcaagttaattacaataagtgag |
7850583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 134 - 228
Target Start/End: Original strand, 8820569 - 8820663
Alignment:
| Q |
134 |
gttcaagataaagaattcgatctccttactactctctcggcgtctccttttataggcgacactttcttgatctaacgggtctttcttttgatgtc |
228 |
Q |
| |
|
||||||||||| ||||| ||| ||| |||| |||||| || ||||||||||||||| ||||||||| | |||| ||| |||||||| |||||| |
|
|
| T |
8820569 |
gttcaagataatgaatttgatgtccctactgctctctaggtgtctccttttataggtctcactttcttcacctaatgggcctttctttggatgtc |
8820663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 227
Target Start/End: Complemental strand, 20000590 - 20000538
Alignment:
| Q |
175 |
gtctccttttataggcgacactttcttgatctaacgggtctttcttttgatgt |
227 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||| ||| |||||||| ||||| |
|
|
| T |
20000590 |
gtctccttttataggcatcactttcttgacctaatgggcctttctttggatgt |
20000538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 135 - 230
Target Start/End: Original strand, 22748919 - 22749014
Alignment:
| Q |
135 |
ttcaagataaagaattcgatctccttactactctctcggcgtctccttttataggcgacactttcttgatctaacgggtctttcttttgatgtcca |
230 |
Q |
| |
|
|||||||||| ||||| |||| ||||| |||||| || ||||||||||||||| |||||||||||| |||| ||| |||||||| ||| |||| |
|
|
| T |
22748919 |
ttcaagataatgaatttgatccatttactgctctctaggtgtctccttttataggtcacactttcttgacctaatgggcctttctttggatttcca |
22749014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 165 - 227
Target Start/End: Original strand, 44078727 - 44078789
Alignment:
| Q |
165 |
ctctctcggcgtctccttttataggcgacactttcttgatctaacgggtctttcttttgatgt |
227 |
Q |
| |
|
|||||| || |||||||||||||||| |||||||||||||||| | |||| ||||| ||||| |
|
|
| T |
44078727 |
ctctctaggtgtctccttttataggcttcactttcttgatctaatgagtctctctttggatgt |
44078789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 85 - 127
Target Start/End: Complemental strand, 13969032 - 13968990
Alignment:
| Q |
85 |
tgttgacgtatgtaaacccaagttaattacaataagtgagctg |
127 |
Q |
| |
|
|||| |||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
13969032 |
tgttcacgtatgtaaacacaagttaattacaacaagtgagctg |
13968990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 83 - 127
Target Start/End: Original strand, 4108903 - 4108947
Alignment:
| Q |
83 |
cctgttgacgtatgtaaacccaagttaattacaataagtgagctg |
127 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||| | |||||||| |
|
|
| T |
4108903 |
cctgtttacgtatgtaaacacaagttaattacaacaggtgagctg |
4108947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 221
Target Start/End: Complemental strand, 13117330 - 13117242
Alignment:
| Q |
134 |
gttcaagataaagaattcgatctcctt-actactctctcggcgtctccttttataggcgacactttcttgatctaacgggtctttcttt |
221 |
Q |
| |
|
||||||||||| |||||||||| |||| | | |||||| | |||||||||||||||| ||||||||||| |||| || |||||||| |
|
|
| T |
13117330 |
gttcaagataatgaattcgatccccttcattgctctctagatgtctccttttataggcctcactttcttgacctaataggcctttcttt |
13117242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University