View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8586_low_14 (Length: 334)
Name: NF8586_low_14
Description: NF8586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8586_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 18 - 186
Target Start/End: Complemental strand, 1349825 - 1349657
Alignment:
| Q |
18 |
tcacttgctctatctttgactctcttaatttcaaatgttgattcagcttctgcttttgttgtaactgctcctaggaagttgcagactgatgaactggcta |
117 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1349825 |
tcacttgctctatctttgactctcttcatttcaaatgttgattcagcttctgcttttgttgtaactgctcctaggaagttgcagactgatgaactggcta |
1349726 |
T |
|
| Q |
118 |
ctgttcgtttgtttcaagagaatactccttctgttgtttatataactaaccttgctgttaagtaagttc |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1349725 |
ctgttcgtttgtttcaagagaatactccttctgttgtttatataactaaccttgctgttaagtaagttc |
1349657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 244 - 334
Target Start/End: Complemental strand, 1349547 - 1349457
Alignment:
| Q |
244 |
atgtatgtttagtataattgatttttaactctagaattgattataagttgcatgtttggttgtgtagtgacaaaaattgattgagtgaatt |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1349547 |
atgtatgtttagtataattgatttttaactctagaattgattataagttgcatgtttggttgtgtagtgacaaaaattgattgagtgaatt |
1349457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University