View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8586_low_22 (Length: 244)
Name: NF8586_low_22
Description: NF8586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8586_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 9378146 - 9378375
Alignment:
| Q |
1 |
atagaaggggaaacattataataaatttgtttatacaatttggagtttagtgttattcaagtaattgcaaccatcctcatccgtattgtttt-ttagtta |
99 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9378146 |
atagaaggggaaacaatataataagtttgtttatacaatttggagtttagtgttattcaagtaattgcaaccatcctcatccgtattgtttttttagtta |
9378245 |
T |
|
| Q |
100 |
atcctctggtttttagggaaaatgggctctgataatccggagttcggttatgaggtaaagatgatatgacctagaattgttccacacaataatcgaactc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
9378246 |
atcctctggtttttagggaaaatgggctctgataatccggagttcggttatgaggtaaatatgatatgacctagaattgttccacacagtaatggaactc |
9378345 |
T |
|
| Q |
200 |
ggattct-ccgaaccatccgtccttggtga |
228 |
Q |
| |
|
||||||| |||||| ||||||||||||||| |
|
|
| T |
9378346 |
ggattctcccgaacgatccgtccttggtga |
9378375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 97 - 145
Target Start/End: Complemental strand, 35581174 - 35581126
Alignment:
| Q |
97 |
ttaatcctctggtttttagggaaaatgggctctgataatccggagttcg |
145 |
Q |
| |
|
|||||||| ||||||||||||||||| | ||||||||| ||||||||| |
|
|
| T |
35581174 |
ttaatcctttggtttttagggaaaatagattctgataattcggagttcg |
35581126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University