View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8586_low_23 (Length: 243)

Name: NF8586_low_23
Description: NF8586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8586_low_23
NF8586_low_23
[»] chr5 (1 HSPs)
chr5 (19-234)||(38025491-38025706)


Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 234
Target Start/End: Complemental strand, 38025706 - 38025491
Alignment:
19 aaggtttccacgccgcctctcgcaagagcttctgcagcggaggatccagcgggtcctccgccaattactgctgctcggagcttgcggccggcgatcgatg 118  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38025706 aaggtttccacgccgccgctcgcaagagcttctgcagcggaggatccagcgggtcctccgccaattactgctgctcggagcttgcggccggcgatcgatg 38025607  T
119 gacgtgtcgaattcgaggcagaaatagtaattgtgtggaagtgttgtttgggttttgaagttggaactgagaatgagggtgaaaaggtttgaattttcaa 218  Q
    | ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
38025606 ggcgtgtcgaattcgaggcagaaatagtaattgagtggaagtgttgtttgggttttgaagttggaactgagaatgaaggtgaaaaggtttgaattttcaa 38025507  T
219 tgccatggagaataat 234  Q
    ||||||||||||||||    
38025506 tgccatggagaataat 38025491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University