View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8586_low_24 (Length: 242)
Name: NF8586_low_24
Description: NF8586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8586_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 6135586 - 6135358
Alignment:
| Q |
1 |
gtaattatgacaacggttaactaataagaacaactttataaagaatacggtgtccaagtttcgcaaaatactactcggatttaggagctatccttttaga |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6135586 |
gtaattttgacaacggttaactaataagaacaactttataaagaatacggtgtccaagtttcgcaaaa-actactcggatttaggagctatccttttaga |
6135488 |
T |
 |
| Q |
101 |
ttgtcatagaatctatattcaacattttgtaaactacggattgagtttactaggatacatgccaacgagactgtccacactttagctaaggcagctacat |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
6135487 |
ttgtcatagaatctatattcgacattttgtaaactacggattgagtttactaggatacat-ccaatgagactgcccacactttagctaaggcagctacat |
6135389 |
T |
 |
| Q |
201 |
cccttactaatttccgctcattaactgatgt |
231 |
Q |
| |
|
| ||||||||||||||||||||||||||||| |
|
|
| T |
6135388 |
ctcttactaatttccgctcattaactgatgt |
6135358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University