View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8586_low_26 (Length: 238)
Name: NF8586_low_26
Description: NF8586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8586_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 39152218 - 39152442
Alignment:
| Q |
1 |
tgtgcaggccaattatttgatatgtattgtatatcaatccatttggcaacatatcggcagtaactataaaacttatgacacaagcaaagtatattcataa |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39152218 |
tgtgcaggccaattatttcatatgtattgtatatcaatccatttggcaacatatcggcagtaactataaaacttatgacacaagcaaagtatattcataa |
39152317 |
T |
|
| Q |
101 |
attataataaggtatgcaagtcattaagaatcataaagcatagatattacttgagctgatcttggcatgctgtgctgctaagaatatgggaaacaaaggt |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39152318 |
attataataagatatgcaagtcattaagaatcataaagcatagatattacttgagctgatcttggcatgctgtgctgctaagaatatgggaaacaaaggt |
39152417 |
T |
|
| Q |
201 |
ggatttttacgttatgcagatggtg |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
39152418 |
ggatttttacgttatgcagatggtg |
39152442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University