View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8586_low_29 (Length: 221)
Name: NF8586_low_29
Description: NF8586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8586_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 21928398 - 21928606
Alignment:
| Q |
1 |
ttttggtaattcagatgggtttgaaggggagactggagatgcatttgaagcacatcagtggaaatgtgttcgaacaatgtctggtactttacttttacca |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21928398 |
ttttggtaattcagatggatttgaaggggaaattggagatgcatttgaagcacatcagtggaaatgtgttcgaacaatgtctggtactttacttttacca |
21928497 |
T |
 |
| Q |
101 |
aacactgatatatggcttgaaatagattgtagaagttgaagaaag-aaaattatgttgacaatgagctgctgttttgtgagatatttccttgtgaacttt |
199 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||| | ||||| |||| | | || | ||||||||||||||||| |||||| |||| ||||||||| |
|
|
| T |
21928498 |
cacactgatatatggcttgaaataggttgtaaaagtggctgaaagaaaaaatctattaagaatgagctgctgttttgcaagatatgtcctagtgaacttt |
21928597 |
T |
 |
| Q |
200 |
cttgtgatg |
208 |
Q |
| |
|
||||||||| |
|
|
| T |
21928598 |
cttgtgatg |
21928606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 48356681 - 48356734
Alignment:
| Q |
18 |
ggtttgaaggggagactggagatgcatttgaagcacatcagtggaaatgtgttc |
71 |
Q |
| |
|
||||||||||||| | |||||| || ||||||||||||| ||||||||||||| |
|
|
| T |
48356681 |
ggtttgaaggggatagtggagacacagttgaagcacatcaatggaaatgtgttc |
48356734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University