View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8587_high_12 (Length: 242)
Name: NF8587_high_12
Description: NF8587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8587_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 28250764 - 28250541
Alignment:
| Q |
1 |
tatctttagagggaatcacgttgagtaagttgctggcatgtaaattaattttaggataacttcttccacaagcatcttttactacaaaaaatagttagaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28250764 |
tatctttagagggaatcacgttgagtaagttgctggcatgtaaatcaattttatgataacttcttccacaagcatcttttactacaaaaaatagttagaa |
28250665 |
T |
|
| Q |
101 |
gaaaataattttttgtaataattcacactttctcttc---aattctctagggcttagtgataataatctcctcttgatttctaatataggaaattatttt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28250664 |
gaaaataattttttgtaataattcacactttctcttcaataattctctagggcttggtg---ataatctcctcttgatttctaatataggaaattatttt |
28250568 |
T |
|
| Q |
198 |
agttttgtttttgattttggacgttct |
224 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
28250567 |
agttttgtttttgattttggacgttct |
28250541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University