View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8587_low_14 (Length: 317)
Name: NF8587_low_14
Description: NF8587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8587_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 109 - 302
Target Start/End: Original strand, 14702007 - 14702200
Alignment:
| Q |
109 |
aattgtgtgatgcaggtaagtgttccatgcagcagtttgacaatggtggtgacagtaagatgtggtcactgcacaagtctcttatctgttaacatgatga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14702007 |
aattgtgtgatgcaggtaagtgttccatgcagcagtttgacaatggtggtgacagtaagatgtggtcactgcacaagtctcttatctgttaacatgatga |
14702106 |
T |
 |
| Q |
209 |
aagcttcttttgtccctttccaccttttagcatctcttactcatcttgaggtcataagttaaagtcacatttccaattctttctttattttctt |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
14702107 |
aagcttcttttgtccctttccaccttttagcatctcttactcatcttgaggtcataagttaaagtcacatttccaatactttgtttattttctt |
14702200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 62
Target Start/End: Original strand, 14701912 - 14701959
Alignment:
| Q |
18 |
ttttctaattgcactt---aagttcatgatatttactttcaataccta |
62 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14701912 |
ttttctaattgcacttcttaagttcatgatatttactttcaataccta |
14701959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University