View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8587_low_21 (Length: 229)
Name: NF8587_low_21
Description: NF8587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8587_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 15 - 173
Target Start/End: Complemental strand, 28722629 - 28722471
Alignment:
| Q |
15 |
gagcacagagaaggggaggataaatgaaggggacaatcacagaggatgggggcggtgccgcggttgcagtcttgcaggaggtgaactacgttttggcttt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28722629 |
gagcacagagaaggggaggataaatgaaggggacaatcacagaggatgggggcggtgccacggttgcagtcttgcaggaggtgaactacgttttggcttt |
28722530 |
T |
|
| Q |
115 |
tccaggataggttttgaatggaataaagattggctacagtaaaatacgttttggctttc |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28722529 |
tccaggataggttttgaatggaataaagattggctacagtaaaatacgttttggctttc |
28722471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University