View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8589_low_5 (Length: 288)
Name: NF8589_low_5
Description: NF8589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8589_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 37 - 275
Target Start/End: Original strand, 22055363 - 22055606
Alignment:
| Q |
37 |
gttattgcatccaaacctactattgtattataactattatataattcctctatagttgaatattattatcaggaacttagtaaacctagttaaatgtatg |
136 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22055363 |
gttattgcatccaaacctactatcgtattataactattatataattcctctatagttgaatattattatcaggaacttagtaaacctagttaaatgtatg |
22055462 |
T |
|
| Q |
137 |
a--taannnnnnnggttttgctgctcac---ttactaatctannnnnnngcttgacattacaccttattatagatgtatgcattaaatttgcagctgcac |
231 |
Q |
| |
|
| | ||||||||||||||| |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22055463 |
attttttttttttggttttgctgctcactgtttactaatgtatttttttgcttgacattacaccttattatagatgtatgcattaaatttgcagctgcac |
22055562 |
T |
|
| Q |
232 |
cttgatatttttatgtcccctcaataacctctcaatgtgatgtc |
275 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
22055563 |
cttgatatttttatgtcccctcagtaacctctcaatgtaatgtc |
22055606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University