View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8589_low_8 (Length: 240)
Name: NF8589_low_8
Description: NF8589
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8589_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 55028477 - 55028704
Alignment:
| Q |
1 |
taaggctgttaattctggtcaacagactgatggctctggtgttttgacacgattgttgcgttctgatttggtttcaacggcgccggaagttgttgatgct |
100 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55028477 |
taaggctgtttattctgggtcacagactgatggcactggtgttttgacacgattgttgcgttctgatttggtttcaacggcgccggaagttgttgatgct |
55028576 |
T |
|
| Q |
101 |
ggagttcccggtagtggtggtggtcatcattggacgagtcttgctgtgcttagtatttgtggctgtggcttgtcggtgagctttattttctcgttattca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55028577 |
ggagttcccggtagtggtggtggtcatcattggacgagtcttgctgtgcttagtatttgtggctgtggcttgtcggtgagctttattttctcgttattca |
55028676 |
T |
|
| Q |
201 |
atgctagttcaagttcaagttttgatgt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
55028677 |
atgctagttcaagttcaagttttgatgt |
55028704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University