View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8590_high_17 (Length: 306)
Name: NF8590_high_17
Description: NF8590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8590_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 289
Target Start/End: Original strand, 56346409 - 56346696
Alignment:
| Q |
1 |
aaaactgatgttcttgcctgtttatgagttatctcataagtannnnnnnncaagcttagttgcactaagctttttgtaaatgtttctgcacacgtctttt |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56346409 |
aaaactgacgttcttgcctgtttatgagttatctcataagtattttttt-caaacttagttgcactaagctttttgtaaatgtttctgcacacgtctttt |
56346507 |
T |
|
| Q |
101 |
cttcagttcagctatgcctagttctgtcattaaaagaagtgagtgagactttgccggttactatatattttgttttgcattatatccctaagaatgatgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56346508 |
cttcagttcagctatgcctagttctgtcattaaaagaagtgagtgagactttgccggttactatatattttgttttgcattatatccctaagaatgatgt |
56346607 |
T |
|
| Q |
201 |
tatttctaaaaagcatattttatcttgatgtatatgtgtcgtttttcctgtatgataatttgtacatattctaacagttcttttatctt |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
56346608 |
tatttctaaaaagcatattttatcttgatgtatatgtgtcgtttttcctgtatcataatttgtacatattctaacagttcttttatctt |
56346696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University