View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8590_high_20 (Length: 243)
Name: NF8590_high_20
Description: NF8590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8590_high_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 43831989 - 43831765
Alignment:
| Q |
1 |
aggaatttgtttgaatgaagaacaagtggaaacatcaatgatgatgaagtgtttgaagacaatagagggtattgctaacaaggcatgtcaaatgggtcgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43831989 |
aggaatttgtttgaatgaagaacaagtggaaacatcaatgatgatgaagtgtttgaagacaatggagggtattgctaacaaggcatgtcaaatgggtcgg |
43831890 |
T |
 |
| Q |
101 |
tctgatccaaggaagattatatttgctgcaaaaatgggtcttgctttgactattatctcccttttgatttttctcaaagaacccttcaacaaagatattg |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43831889 |
tctgatccaaggaagattatatttgccgcaaaaatgggtcttgctttgactattatctcccttttgatttttctcaaagaacccttcaacaaagatattg |
43831790 |
T |
 |
| Q |
201 |
gtcgtaactctgtttgggctattct |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43831789 |
gtcgtaactctgtttgggctattct |
43831765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 90 - 225
Target Start/End: Complemental strand, 43816996 - 43816861
Alignment:
| Q |
90 |
aaatgggtcggtctgatccaaggaagattatatttgctgcaaaaatgggtcttgctttgactattatctcccttttgatttttctcaaagaacccttcaa |
189 |
Q |
| |
|
|||||||||| ||||||||||| ||||| || |||||||| ||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
43816996 |
aaatgggtcgttctgatccaagaaagatcatttttgctgctaaaatgggtcttgctttgactattatctcccttttgattttccttaaagaacccttcaa |
43816897 |
T |
 |
| Q |
190 |
caaagatattggtcgtaactctgtttgggctattct |
225 |
Q |
| |
|
|| |||||| | ||| ||||||||||||||||||| |
|
|
| T |
43816896 |
aaatgatattagccgtcactctgtttgggctattct |
43816861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 90 - 187
Target Start/End: Complemental strand, 43824932 - 43824835
Alignment:
| Q |
90 |
aaatgggtcggtctgatccaaggaagattatatttgctgcaaaaatgggtcttgctttgactattatctcccttttgatttttctcaaagaacccttc |
187 |
Q |
| |
|
|||||||||| ||||||||||||||||| || || ||||| |||||||||||||||||| | |||||||||||||||||||||| |||||||||||| |
|
|
| T |
43824932 |
aaatgggtcgttctgatccaaggaagatcattttcgctgctaaaatgggtcttgctttggcccttatctcccttttgatttttcttaaagaacccttc |
43824835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University