View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8590_high_22 (Length: 237)
Name: NF8590_high_22
Description: NF8590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8590_high_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 17 - 221
Target Start/End: Original strand, 783578 - 783785
Alignment:
| Q |
17 |
gggcaaataggattaagccaatgccaaaaacaaaggaagcatagttaactctttcaaaagaatgaggaaannnnnnnnnnnnnnnnnnggaaaagtaaat |
116 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
783578 |
gggcaaagaggattaagccaatgccaaaaacaaaggaagcatagttaactctttcaaaagaatgaggaaaagagagagatagagagagggaaaagtaaat |
783677 |
T |
 |
| Q |
117 |
acttcagaaataaaataaccaactcatccatcaag---nnnnnnnnnnnnnngttgggtgaggggttggatctcaatattaggagtatgttctttttgag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
783678 |
acttcagaaataaaataaccaactcatccatcaagtttttttttctttttttgttgggtgaggggttggatctcaatattaggagtatgttctttttgag |
783777 |
T |
 |
| Q |
214 |
gttacttt |
221 |
Q |
| |
|
|||||||| |
|
|
| T |
783778 |
gttacttt |
783785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University