View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8590_low_27 (Length: 300)
Name: NF8590_low_27
Description: NF8590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8590_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 112 - 284
Target Start/End: Complemental strand, 30472171 - 30471998
Alignment:
| Q |
112 |
gtgagccaaatcttcaacctccattgcaaatctccaaacgagatccaaacacttatcttctgctactcgaacgaaa-cccgtccacaaaaaccacaaatc |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30472171 |
gtgagccaaatcttcaaccaccattgcaaatctccaaacgagatccaaacacttatcttccactactcgaacgaaaacccgtccacaaaaaccacaaatc |
30472072 |
T |
 |
| Q |
211 |
gatggatggaggttttatatttaaggatggatgaaggtaattaaattggacatattaggatcaattgagtgatg |
284 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30472071 |
gatggatggtggttttatatttaaggatggatgaaggtaattaaattggacatattaggatcaattgagtgatg |
30471998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University