View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8590_low_36 (Length: 224)
Name: NF8590_low_36
Description: NF8590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8590_low_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 11 - 208
Target Start/End: Original strand, 5076452 - 5076651
Alignment:
| Q |
11 |
gtttggtgttcataagaatttctaaaagatttgaacataagaatgcaatgtgagttagtttgaccatgaaaactaaccacaacactagaataatttagag |
110 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5076452 |
gtttagtgttcgtaagaatttctaaaagatttgaatataagaatgcaatgtgagtaagtttgaccatgaaagctaaccacaacactagaataatttagag |
5076551 |
T |
 |
| Q |
111 |
at--gagtttgagtttcaaattaacgaataaaagtatcagaccttgaatgttgaaaataataagtaatttgttggtgcaaataaaagaagatcaagaaag |
208 |
Q |
| |
|
|| ||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5076552 |
atatgagtttgagtttcaaattaacgaataagagtatcagaccttaaatgttgaaaataataagtaatttgttggtgcaaataaaagaagatcaagaaag |
5076651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University