View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8590_low_39 (Length: 220)
Name: NF8590_low_39
Description: NF8590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8590_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 7 - 211
Target Start/End: Complemental strand, 21317214 - 21317011
Alignment:
| Q |
7 |
gtacaatcactttaatgacttaccacttttgataccttctagcatccattcttatttgggtgttggagtgtcttttgaaaatacaccccctctctttcag |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21317214 |
gtacgatcactttaatgacttaccacttttgataccttctagcacccattcttatttaagtgttggagtgtcttttgaaaatacaccccctctctttcag |
21317115 |
T |
|
| Q |
107 |
aaggagcatatgactagttattgtaattcaattcacaggtgaaggagcaacaccttgttgctcaagaggtacagttcatttttcctataggaacattgat |
206 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||| |||||| | || |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21317114 |
aaggagcatatgactagttatcgtaattcaactcacaggtgaaggaggaacacc-tctttctcaagaggtacagttcatttttcgtataggaacattgat |
21317016 |
T |
|
| Q |
207 |
gtcca |
211 |
Q |
| |
|
||||| |
|
|
| T |
21317015 |
gtcca |
21317011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University