View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8590_low_4 (Length: 450)
Name: NF8590_low_4
Description: NF8590
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8590_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 408; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 408; E-Value: 0
Query Start/End: Original strand, 1 - 437
Target Start/End: Complemental strand, 3713621 - 3713189
Alignment:
| Q |
1 |
gcctggtcggtaaataaagacatcgaacaactacaattttggagacagatgaattttgcagatcatatatacttgatgctaatttgctgaaaatcttaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3713621 |
gcctggtcggtaaataaagacatcgaacaactacaattttggagacagatgaattttgcagatcata----cttgatgctaatttgctgaaaatcttaat |
3713526 |
T |
|
| Q |
101 |
tccgtatcagttggttcagttatagtatatcccttatggtagggatggtcaatgagatgtccctagtgtttaaaaatgatctgaaaatacgggttgggga |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3713525 |
tccctatcagttggttcagttatagtatatcccttatggtagggatggtcaatgagatgtccctagtgtttaaaaatgatctgaaaatacgggttgggga |
3713426 |
T |
|
| Q |
201 |
gacaaatgtggacccttgatatcttcagcttcgtttcaaggttcatctttccaaacacctgcatgttctcttaaagatccccttctatcccatacaaaac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3713425 |
gacaaatgtggacccttgatatcttcagcttcgtttcaaggttcatctttccaaacacctgcatgttctcttaaagatccccttctatcccatacaaaac |
3713326 |
T |
|
| Q |
301 |
ctacatttaatgcaccttctattctaacattacatataactgaacctagacattcatacaaacattgagtctttattcttgttctgcattttatctcaac |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3713325 |
ctacatttaatgcaccttctattctaacattacatataactgaacctagacattcatacaaacattgagtctttattattgttctgcattttatctcaac |
3713226 |
T |
|
| Q |
401 |
atggcttcacttcctcttcttctgctcctcatcctct |
437 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3713225 |
atggcttctcttcctcttcttctgctcctcatcctct |
3713189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University