View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8591_high_15 (Length: 302)
Name: NF8591_high_15
Description: NF8591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8591_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 20 - 293
Target Start/End: Original strand, 24301113 - 24301386
Alignment:
| Q |
20 |
cattcttgtaccaattttcatttgggcttcgaagcccgcagtgtgggttcggatgagcatctgtttagagctattgatgagcttttttcaactcaacgag |
119 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||||||| |||| ||| |||||| |||| ||| ||||||||| | || |||| |
|
|
| T |
24301113 |
cattcttgtaccaattttcacttgggctttgaagcccgcagtgtgggttatgatgcgcacctgtttggagccatttatgagctttcatacgcttaacgga |
24301212 |
T |
 |
| Q |
120 |
gaaacttttcttcaacattgatcagagtccactccaacacttccaacatatttttgacacatatatcatcatttacaatggtgtaggaagaggatattac |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24301213 |
gaaacttttcttcaacattgatcagagtccactccaacacttccaacatatttctgacacgtatatcatcatttacaatggtgtaggaagatgatattac |
24301312 |
T |
 |
| Q |
220 |
ttgaactaatcataacatttaaaaggacatgaaacttatttatccgtaatattaaatgtcatatttagtattat |
293 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |||||| |
|
|
| T |
24301313 |
tttcactaatcataacatttaaaaggacatgaaacttatttatccctaatattaaatctcatatttaatattat |
24301386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University