View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8591_high_17 (Length: 286)
Name: NF8591_high_17
Description: NF8591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8591_high_17 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 19 - 286
Target Start/End: Original strand, 39194609 - 39194876
Alignment:
| Q |
19 |
aggagtacatctatatcggtttctttttggtcaagtatttataaactatactagcatcttgaaattaagaaggggaccataggcaagagggttacatata |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39194609 |
aggagtacatctatatcggtttctttttggtcaagtatttataaactatactagcatcttgaaattaagaaggggaccataggcaagagggttacatata |
39194708 |
T |
|
| Q |
119 |
taaactttggaaagtctgtatgtattttaacgaacatgtgagtgagggcccaaaagctggttcttgcctttatactacgtttgtttgtggttgctatccc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39194709 |
taaactttggaaagtctgtatgtattttaacgaacatgtgagtgagggcccaaaagctggttcttgcctttatactacgtttgtttgtggttgctatctc |
39194808 |
T |
|
| Q |
219 |
tttcaactttcatgccttaactttttagggtcatctatcttaatttctgtacaaagctgcatcttgac |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39194809 |
tttcaactttcatgccttaactttttagggtcatctatcttaatttctgtacaaagctgcatcttgac |
39194876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University