View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8591_low_17 (Length: 309)
Name: NF8591_low_17
Description: NF8591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8591_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 18 - 292
Target Start/End: Original strand, 4338099 - 4338373
Alignment:
| Q |
18 |
ctggtgatgttgttgaatatggttcccggcttttcgtggtgggcttttcctttgccttgcttgtgggtttacctgtggcttggtttggaactgttggggc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4338099 |
ctggtgatgttgttgaatatggttcccggcttttcgtggtgggcttttcctttgccttgcttgtggggttacctgtggcttggtttggaactgttggggc |
4338198 |
T |
|
| Q |
118 |
acaatctgagcctgctaagaggattgtttgtgctgcttctagtggtgttctggctgttacttttgcggttgttaggatgtatcttggttgggcttatgtt |
217 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4338199 |
acaatatgagcctgctaagaggattgtttgtgctgcttctagtggtgttctggctgttacttttgcggttgttaggatgtatcttggttgggcttatgtt |
4338298 |
T |
|
| Q |
218 |
gggaatcgtttgctcagtgctactgttgaatgtaatgtgtattttctctctactttttaatcttatgtctaagat |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4338299 |
gggaatcgtttgctcagtgctactgttgaatgtaatgtgtattttctctctactttttaatcttatgtctaagat |
4338373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University