View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8591_low_24 (Length: 285)
Name: NF8591_low_24
Description: NF8591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8591_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 21 - 245
Target Start/End: Original strand, 29593918 - 29594141
Alignment:
| Q |
21 |
ttctcagatgtgaattgagaattagaagccttctaattgtgataggacttctaatattggaagtggttttgctataaacttatgtatgtcagttagaaaa |
120 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| ||||| |||||| || |
|
|
| T |
29593918 |
ttcttagatgtgaattgagaattagaagccttctaattgtgataggacttctaatatcggaagtggttttgctataaatttatgcatgtcggttagacaa |
29594017 |
T |
 |
| Q |
121 |
tgcattactcttttaggtattgtgggggaatggtttagattattgtcgaaagtaatgatttattattatacactaatttgtggtttaaggggttaatttg |
220 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29594018 |
ggcatt-ctcttttaggtattgtgggggaatggtttagattattgtcgaaagtaatgatttattattatacactaatttgtggtttaaggggttaatttg |
29594116 |
T |
 |
| Q |
221 |
ctttagttgaagttgaattgatggt |
245 |
Q |
| |
|
||||||||||||| ||||||||||| |
|
|
| T |
29594117 |
ctttagttgaagtcgaattgatggt |
29594141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University