View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8591_low_30 (Length: 251)
Name: NF8591_low_30
Description: NF8591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8591_low_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 35 - 237
Target Start/End: Complemental strand, 33910639 - 33910432
Alignment:
| Q |
35 |
ttatcaaataaacc-atagaatcataatagtcggtagaggatgtactcaaaatctattgcatcgccaagatgtatacc-ttctcataatttctacgtgag |
132 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| | ||||||||| |||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
33910639 |
ttatcaaataaacctataggatcataatagtatgcagaggatgtcctcaaaatctattgcatcgccaagatgt-taccattctcataatttctacgtgag |
33910541 |
T |
|
| Q |
133 |
tgacattgggccccatg----tgtctaaatgcttttaaagcattaagcatgttatgagtgacaattgcccctccatgcgcccatccagtgacaatgatat |
228 |
Q |
| |
|
|||||||||| |||||| |||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33910540 |
tgacattgggtcccatgcatgtgtccaaatgcttttaaagcattaagcatgttatgagtgacaattgcccttccatgcgcccatccagtgacaatgatat |
33910441 |
T |
|
| Q |
229 |
aaaggagaa |
237 |
Q |
| |
|
||||||||| |
|
|
| T |
33910440 |
aaaggagaa |
33910432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University