View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8591_low_37 (Length: 202)
Name: NF8591_low_37
Description: NF8591
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8591_low_37 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 19 - 183
Target Start/End: Original strand, 44348842 - 44349006
Alignment:
| Q |
19 |
aggtggtgtcttggtgccttgggtggctaaggatggtgtgtcgggttggtgtggttgttggcaggaggggtggcggcagtggcagcctgcataattctgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44348842 |
aggtggtgtcttggtgccttgggtggctaaggctggtgtgtcgggttggtgtggttgttggcaggaggggtggcggcagtggcagcctgcataattctgc |
44348941 |
T |
|
| Q |
119 |
aggttgttgtctgttgttttgtgctgcagcagctagtttgtgctgctgctggttgaggggtgggt |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44348942 |
aggttgttgtctgttgttttgtgctgcagcagctagtttgtgctgctgctggttgaggggtgggt |
44349006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University