View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8593_high_7 (Length: 330)
Name: NF8593_high_7
Description: NF8593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8593_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 1 - 313
Target Start/End: Original strand, 35579105 - 35579417
Alignment:
| Q |
1 |
gtggatcaggcaattgagttgttggttgatatgtttgagagtgaaaagtgtcagccgacggttattagttacaatactgttcttcttggattatgcaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35579105 |
gtggatcaggcaattgagttgttggttgatatgtttgagagtgaaaagtgtcagccgacggttattagttacaatactgttcttcttggattatgcaaag |
35579204 |
T |
 |
| Q |
101 |
tgcaaagaatcatagatgctattgaggtgctggctgctatggttaacgaaggatgtctgccaaatgaaaccacttacacattgttgattcaagggattgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35579205 |
tgcaaagaatcatagatgctattgaggtgctggctgctatggttaacgaaggatgtctgccaaatgaaaccacttacacattgttgattcaagggattgg |
35579304 |
T |
 |
| Q |
201 |
ttttgctggatggcgatatgacgcaatggagctggctaacttacttgttaatatggatgcaatttcagaagattcgttcaaacgttttcagaaaatattt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35579305 |
ttttgctggatggcgatatgacgcaatggagctggctaacttacttgttaatatggatgcaatttcagaagattcgttcaaacgttttcagaaaatattt |
35579404 |
T |
 |
| Q |
301 |
ctggtgtttgatg |
313 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
35579405 |
ccggtgtttgatg |
35579417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University