View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8593_low_14 (Length: 238)
Name: NF8593_low_14
Description: NF8593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8593_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 42335847 - 42335625
Alignment:
| Q |
1 |
ttcagaaaagcagccaccaaaaggaagagttttgaaggagaagagagcaaagttttacattattcgaagatgcatagtcatgcttctctgttggaaggat |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42335847 |
ttcagaaaagcagctaccaaaaggaagagttttgaaggagaagagagcaaagttttacattattcgaagatgcatagtcatgcttctctgttggaaggat |
42335748 |
T |
|
| Q |
101 |
aaaggagacaaggaataataccggtaaaacactcgctcacttcaaagaacactgtttctactgttcatgtatattccattattctaaggtaaataaaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42335747 |
aaaggagacaaggaataataccggtaaaacactcactcacttcaaagaacactgtttctactgttcatgtatattccattgttctaaggtaaataaaaat |
42335648 |
T |
|
| Q |
201 |
ggttataatattgcagttgtttt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42335647 |
ggttataatattgcagttgtttt |
42335625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University