View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8594_high_3 (Length: 238)
Name: NF8594_high_3
Description: NF8594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8594_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 37028715 - 37028930
Alignment:
| Q |
1 |
gatccattcttcattgaaagctgccctcatgtttactttgttggcaatcaggataaatatgatactcgcgtgataaagggtatttttaattcttaa-tct |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
37028715 |
gatccattcttcattgaaagctgccctcatgtttactttgttggcaatcaggataaatatgatactcgcgtgataaagggtatttttaattcttaaatct |
37028814 |
T |
|
| Q |
100 |
acattgcagaaacacattaccttttccgttttgcattttatacaacttctccctcctcccaacactaatgcattttaatcattgattgcaggatcagaag |
199 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37028815 |
acattgtagaaacacattaccttttccgttttgcattttatacaacttctccctcctcccaacactaatacattttaatcattgattgcaggatcagaag |
37028914 |
T |
|
| Q |
200 |
gccaattagttagact |
215 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
37028915 |
gccaattagttagact |
37028930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University