View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8595_low_15 (Length: 241)
Name: NF8595_low_15
Description: NF8595
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8595_low_15 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 7 - 241
Target Start/End: Original strand, 17454995 - 17455230
Alignment:
| Q |
7 |
tggacatcaacattgtagaacctgcaaagcatgtaagttttgacatcataccgaagataaaattgttattttaatttttcatttctatatgtacttatgc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
17454995 |
tggacatcaacattgtagaacctgcaaagcatgtaagttttgacatcataccgaagataaaattgttattttattttttcatttctatatgtacttttgc |
17455094 |
T |
|
| Q |
107 |
atgcattaccaaatga-nnnnnnnnnnnaggggacattggaagcagctctgcaagttcaaaccttgaagatgatgaaattgatgctgaaatgtacattca |
205 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17455095 |
atgcattaccaaatgatttattttttttaggggacattggaagcagctctgcaggttcaaaccttgaagacgatgaaattgatgctgaaatgtacattca |
17455194 |
T |
|
| Q |
206 |
accgggaaatccacacttcattgcaaaacatagtct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
17455195 |
accgggaaatccacacttcattgcaaaacatagtct |
17455230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 134 - 233
Target Start/End: Complemental strand, 17393749 - 17393650
Alignment:
| Q |
134 |
aggggacattggaagcagctctgcaagttcaaaccttgaagatgatgaaattgatgctgaaatgtacattcaaccgggaaatccacacttcattgcaaaa |
233 |
Q |
| |
|
|||| ||||||| |||||||||||| | ||||| ||||||||||| ||||||||||||||||| || ||||||||||||||||| ||||| ||||||||| |
|
|
| T |
17393749 |
agggaacattgggagcagctctgcacgatcaaaacttgaagatgacgaaattgatgctgaaatatatattcaaccgggaaatcctcactttattgcaaaa |
17393650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 140 - 236
Target Start/End: Original strand, 17461363 - 17461459
Alignment:
| Q |
140 |
cattggaagcagctctgcaagttcaaaccttgaagatgatgaaattgatgctgaaatgtacattcaaccgggaaatccacacttcattgcaaaacat |
236 |
Q |
| |
|
||||||||| ||||||||| | |||| |||||||||||||||||||||||||||||||| ||||| || ||||||||| ||||| |||||||||| |
|
|
| T |
17461363 |
cattggaagtagctctgcagctccaaatcttgaagatgatgaaattgatgctgaaatgtatattcagccaggaaatccatacttctatgcaaaacat |
17461459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 140 - 235
Target Start/End: Complemental strand, 40235230 - 40235135
Alignment:
| Q |
140 |
cattggaagcagctctgcaagttcaaaccttgaagatgatgaaattgatgctgaaatgtacattcaaccgggaaatccacacttcattgcaaaaca |
235 |
Q |
| |
|
||||||||||||||||||| | |||| | |||||||||||||||||||| ||||||||| ||||| || |||||||| ||||| ||||||||| |
|
|
| T |
40235230 |
cattggaagcagctctgcagctccaaaacatgaagatgatgaaattgatgttgaaatgtatattcagccaggaaatccttacttctatgcaaaaca |
40235135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 10 - 63
Target Start/End: Complemental strand, 40235375 - 40235321
Alignment:
| Q |
10 |
acatcaacattgtagaacctgcaaagcatgtaag-ttttgacatcataccgaaga |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||||| ||||| |
|
|
| T |
40235375 |
acatcaacattgtagaacctgcaaagcatgtatgtttttgacatcatactgaaga |
40235321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University