View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8596_low_6 (Length: 266)
Name: NF8596_low_6
Description: NF8596
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8596_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 6e-43; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 95 - 187
Target Start/End: Complemental strand, 35975133 - 35975041
Alignment:
| Q |
95 |
tgatgttgtgcaggttgtagagggtgtgtgtaatgaccagatggatttttcgtggatggataactttgacattacagatgaatacttgaagag |
187 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35975133 |
tgatgttgtgtaggttgtagagggtgtgtgtaatgaccagatggatttttcgtggatggataactttgacattacagatgaatacttgaagag |
35975041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 95 - 164
Target Start/End: Complemental strand, 35978072 - 35978003
Alignment:
| Q |
95 |
tgatgttgtgcaggttgtagagggtgtgtgtaatgaccagatggatttttcgtggatggataactttgac |
164 |
Q |
| |
|
||||| ||||| ||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35978072 |
tgatgctgtgctggttggagagggtgtgtgtaatgaccagatggatttttcatggatggataactttgac |
35978003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 195 - 251
Target Start/End: Complemental strand, 35974913 - 35974857
Alignment:
| Q |
195 |
tggggcatgtagatgataatctaattgatgaatatggggcaatgcaaagtttggatt |
251 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35974913 |
tggggcatatagatgataatctaattgatgaatatggggcaatgcaaagtttggatt |
35974857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 64
Target Start/End: Complemental strand, 35978139 - 35978103
Alignment:
| Q |
28 |
ttggtggtggtgaaagccaagatgcaaattcagaagg |
64 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35978139 |
ttggtggtggtgaaatccaagatgcaaattcagaagg |
35978103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University