View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8597_low_10 (Length: 219)

Name: NF8597_low_10
Description: NF8597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8597_low_10
NF8597_low_10
[»] chr4 (1 HSPs)
chr4 (69-219)||(331414-331564)


Alignment Details
Target: chr4 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 69 - 219
Target Start/End: Original strand, 331414 - 331564
Alignment:
69 cagaaaactgcattagttgtatagttattgacatcggaccagtctcggcatttggatgttgtggatttgtttcttagacggttgctctatgtgcctcttg 168  Q
    ||||||||||||||||||||||| |||||||||| || ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||    
331414 cagaaaactgcattagttgtataattattgacattgggccagtctcggcatttggctgatgtggatttgtttcttagacggttgctctatgtgcctcttg 331513  T
169 gattactcaacccctaaataagccgatccggagatagcttcagacgaaaaa 219  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||    
331514 gattactcaacccctaaataagtcgatccggagatagcttcagacgaaaaa 331564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University