View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8597_low_5 (Length: 297)
Name: NF8597_low_5
Description: NF8597
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8597_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 14 - 263
Target Start/End: Complemental strand, 40193413 - 40193164
Alignment:
| Q |
14 |
ttcttattcatggctgatattttttgaccgaaagacaacaatgttttttaatatttgtcgacgtaaatctttccgtcggcatgctaccttttacatgtat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40193413 |
ttcttattcatggctgatattttttgaccgcaagacaacaatgtttttttatatttgtcgacgtaaatctttccgtcggcatgctaccttttacatgtat |
40193314 |
T |
|
| Q |
114 |
gtttcctttgttgcttttgccttgtaaggatctatttggttgccatatgctacacactttatcttttcaaattttagggagggcatgcccactaaattaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40193313 |
gtttcctttgttgcttttgccttgtaaggatctatttggttgccatatgctacacactttatcttttcaaattttagggagggcatgcccactaaattaa |
40193214 |
T |
|
| Q |
214 |
aggtaaaagagaaaataaataaataaagaggatccttgctggatatacta |
263 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
40193213 |
aggtaaaagagaaaaaaataaaataaagaggatccttgctggatatacta |
40193164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University