View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8598_low_3 (Length: 307)
Name: NF8598_low_3
Description: NF8598
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8598_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 291
Target Start/End: Original strand, 36333296 - 36333586
Alignment:
| Q |
1 |
agagaaggatactagtagtattatgttgtactaacnnnnnnncaaagtgagaatcttttgagtacttatcaaagnnnnnnnncacattaaaaagtgactc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
36333296 |
agagaaggatactagtagtattatgttgtactaacaaaaaaacaaagtgagaatcttttgagtacttatcaaagttttttttcgcattaaaaagtgactc |
36333395 |
T |
|
| Q |
101 |
attctcacacactcttcacttgatatagtgaaaacttgtgtttctctaacacaagtctaaagaaacagttcacaaaaaatggctgaaaatgatccatttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36333396 |
attctcacacactcttcacttgatatagtgaaaacttgtgtttctctaacacaagtctaaagaaacagttcacaaaaaatggctgaaaatgatccatttt |
36333495 |
T |
|
| Q |
201 |
gctatccatatcacattgaagatgattgcattcctactgaaaaatggtcaaatggacttcaacattctcaaaattcagtgagcacgcttta |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36333496 |
gctatccatatcacattgaagatgattgcattcctactgaaaaatggtcaaatggacttcaacattctcaaaattcagtgagcacacttta |
36333586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000007; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 43 - 74
Target Start/End: Complemental strand, 2629701 - 2629670
Alignment:
| Q |
43 |
caaagtgagaatcttttgagtacttatcaaag |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2629701 |
caaagtgagaatcttttgagtacttatcaaag |
2629670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 43 - 74
Target Start/End: Complemental strand, 22979622 - 22979591
Alignment:
| Q |
43 |
caaagtgagaatcttttgagtacttatcaaag |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
22979622 |
caaagtgagaatcttttgagtacttatcaaag |
22979591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 43 - 74
Target Start/End: Original strand, 23808782 - 23808813
Alignment:
| Q |
43 |
caaagtgagaatcttttgagtacttatcaaag |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
23808782 |
caaagtgagaatcttttgagtacttatcaaag |
23808813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University