View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8600_low_5 (Length: 257)
Name: NF8600_low_5
Description: NF8600
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8600_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 26 - 239
Target Start/End: Original strand, 25391455 - 25391668
Alignment:
| Q |
26 |
acttttcttagaaaattgctcttctcacttccaaaatttctctcagccactccgaaataaccaaatttcccccaatgacaattaattgtcattcggtctt |
125 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25391455 |
acttttcttagaaaatttcccttctcacttccaaaatttctctcagccactccgaaataaccaaatttcccccgatgacaattaattgtcattcggtctt |
25391554 |
T |
 |
| Q |
126 |
aacaacaattaagtgaaacatcatcctttcaccctaaatttcttcagtaaaaagtcatatacataagtgaaacatctaccaaatgaactatggggtgaat |
225 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25391555 |
aacaacaattaagtgaaacgtcatcctttcaccctaaatttcttcagtaaaaagtcatatacataagtgaaacatctaccaaatgaactatggggtgaat |
25391654 |
T |
 |
| Q |
226 |
ttgtatctactgct |
239 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
25391655 |
ttgtatctactgct |
25391668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University