View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8601_high_11 (Length: 358)
Name: NF8601_high_11
Description: NF8601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8601_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 1 - 338
Target Start/End: Original strand, 41899964 - 41900305
Alignment:
| Q |
1 |
tcatggattggaaaatacactgccaaacaaatagtagcttatttttggggaaattgctaaatctagcgagaaactatcatagcgaagccttcgtgaannn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
41899964 |
tcatggattggaaaatacactgccaaacaaatagtagcttttttttggggaaattgctgaatctagcgagaaactatcatagcaaagacttcgtgaattg |
41900063 |
T |
 |
| Q |
101 |
nnnnnnnnnnnnnnngtagttaaaactactccaaggtgttcaagt-ccgaaagacttatggcacattataagaaattttggtgagttgcaaacaattttg |
199 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
41900064 |
tttttttttttt---gtagttaaaactactccaaggtgtttaagtaccgaaagacttatggcacatcataagaaattttggtgagatgcaaacaattttg |
41900160 |
T |
 |
| Q |
200 |
gcaaaaagt----caggaaaattggatcaacatttttagcattgggcaataagcttctttgtataggaatttgaaaaccaaaaatggtatcaaatatatg |
295 |
Q |
| |
|
||||||||| |||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
41900161 |
gcaaaaagtaagtcaggaaaattggataaatgtttttagcattgggcaataagcttctttgtataggaatttgaaaaccaaaaattgtatcaaatatatg |
41900260 |
T |
 |
| Q |
296 |
ttagaattggtctactttaaaaaggattctaaa--ctaaactaaa |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41900261 |
ttagaattggtctactttaaaaaggattctaaagtctaaactaaa |
41900305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000008; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 49 - 92
Target Start/End: Original strand, 14693778 - 14693821
Alignment:
| Q |
49 |
ggaaattgctaaatctagcgagaaactatcatagcgaagccttc |
92 |
Q |
| |
|
||||||||||||||||||||||||||| | | |||||||||||| |
|
|
| T |
14693778 |
ggaaattgctaaatctagcgagaaactgtaacagcgaagccttc |
14693821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 49 - 92
Target Start/End: Original strand, 14700192 - 14700235
Alignment:
| Q |
49 |
ggaaattgctaaatctagcgagaaactatcatagcgaagccttc |
92 |
Q |
| |
|
||||||||||||||||||||||||||| | | |||||||||||| |
|
|
| T |
14700192 |
ggaaattgctaaatctagcgagaaactgtaacagcgaagccttc |
14700235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University