View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8601_high_16 (Length: 268)
Name: NF8601_high_16
Description: NF8601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8601_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 3094022 - 3093763
Alignment:
| Q |
1 |
ccgttgaaattggccccaagattttttctagaatgaatccacccctgaatgcttcttggtccaggctctccatcctctctattgcttttgctatggcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3094022 |
ccgttgaaattggccccaagattttttctagaatgaatccacccctgaatgcttcttggtccaggctctccatcctctctattgcttttgctatggcttc |
3093923 |
T |
 |
| Q |
101 |
tggggtcctttgctttggtggcaactttgagaattgaccaatctgcatttgtaatatttgtgagcaaattaaaaataacatcaatatttatacttagaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3093922 |
tggggtcctttgctttggtggcaactttgagaattgaccaatctgcatttgtaatatttgtgagcaaattaaaaataacatcaatatttatacttagaaa |
3093823 |
T |
 |
| Q |
201 |
tatatgaaggcggactatgggatctcacattcgtgacaatgttgacaatctgatgtccat |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3093822 |
tatatgaaggcggactatgggatctcacattcgtgacaatgttgacaatctgatgaccat |
3093763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 30 - 178
Target Start/End: Complemental strand, 3085147 - 3084999
Alignment:
| Q |
30 |
agaatgaatccacccctgaatgcttcttggtccaggctctccatcctctctattgcttttgctatggcttctggggtcctttgctttggtggcaactttg |
129 |
Q |
| |
|
||||||||||||||||| || ||||||||||| ||||| || |||||| ||||||||||||||||||||| | | || ||||||||||||||||||||| |
|
|
| T |
3085147 |
agaatgaatccaccccttaaagcttcttggtctaggctttctatcctccctattgcttttgctatggcttgtagaatcatttgctttggtggcaactttg |
3085048 |
T |
 |
| Q |
130 |
agaattgaccaatctgcatttgtaatatttgtgagcaaattaaaaataa |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3085047 |
agaattgaccaatctgcatttgtaatatttgtgagtaaattaaaaataa |
3084999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University