View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8601_high_17 (Length: 258)
Name: NF8601_high_17
Description: NF8601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8601_high_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 7 - 107
Target Start/End: Original strand, 5335460 - 5335560
Alignment:
| Q |
7 |
gttgtgaggagacagaggaaggatttgaaagcgaggatgcttgaggtttcgagggaagaagcggagaggaagaggatgcttgatgaacgggcgaattaca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5335460 |
gttgtgaggagacagaggaaggatttgaaagcgaggatgcttgaggtttcgagggaagaagcggagaggaagaggatgcttgatgaacgggcgaattaca |
5335559 |
T |
|
| Q |
107 |
g |
107 |
Q |
| |
|
| |
|
|
| T |
5335560 |
g |
5335560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 182 - 240
Target Start/End: Original strand, 5335635 - 5335693
Alignment:
| Q |
182 |
ctcctaattaaggtttagtgaagaattgtaatcacttattcaatttgtgataattaaaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||||| || |||||| |
|
|
| T |
5335635 |
ctcctaattaaggtttagtgaagaattataatcactggttcaatttgtgttagttaaaa |
5335693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University