View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8601_high_17 (Length: 258)

Name: NF8601_high_17
Description: NF8601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8601_high_17
NF8601_high_17
[»] chr7 (2 HSPs)
chr7 (7-107)||(5335460-5335560)
chr7 (182-240)||(5335635-5335693)


Alignment Details
Target: chr7 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 7 - 107
Target Start/End: Original strand, 5335460 - 5335560
Alignment:
7 gttgtgaggagacagaggaaggatttgaaagcgaggatgcttgaggtttcgagggaagaagcggagaggaagaggatgcttgatgaacgggcgaattaca 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5335460 gttgtgaggagacagaggaaggatttgaaagcgaggatgcttgaggtttcgagggaagaagcggagaggaagaggatgcttgatgaacgggcgaattaca 5335559  T
107 g 107  Q
    |    
5335560 g 5335560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 182 - 240
Target Start/End: Original strand, 5335635 - 5335693
Alignment:
182 ctcctaattaaggtttagtgaagaattgtaatcacttattcaatttgtgataattaaaa 240  Q
    ||||||||||||||||||||||||||| ||||||||  ||||||||||| || ||||||    
5335635 ctcctaattaaggtttagtgaagaattataatcactggttcaatttgtgttagttaaaa 5335693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University