View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8601_high_22 (Length: 225)

Name: NF8601_high_22
Description: NF8601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8601_high_22
NF8601_high_22
[»] chr4 (1 HSPs)
chr4 (1-105)||(22054918-22055022)


Alignment Details
Target: chr4 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 22055022 - 22054918
Alignment:
1 gtgttcagatcatattttgagttaaatatgcaattaatttgattactgtatccttagaaggctaattcaattacctacaactagtatgttcaacccgaag 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
22055022 gtgttcagatcatattttgagttaaatatgcaattaatttgattactgtatccttagaaggctaattcaattacctacaactagtatgttcagcccgaag 22054923  T
101 tctaa 105  Q
    |||||    
22054922 tctaa 22054918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University