View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8601_low_29 (Length: 299)
Name: NF8601_low_29
Description: NF8601
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8601_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 269; Significance: 1e-150; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 285
Target Start/End: Complemental strand, 32817970 - 32817686
Alignment:
| Q |
1 |
atggcaatagcaggtatgtattgtaacctagattgaacgagtttacgaggcaagttttaggccctttcatgtgcatcatgaaacaaattgcatttcatat |
100 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32817970 |
atggcaatagcaggtatgtattataagctagattgaacgagtttaccaggcaagttttaggccctttcatgtgcatcatgaaacaaattgcatttcatat |
32817871 |
T |
 |
| Q |
101 |
ggactagcattatccgcaaggccagcaatgacgttgttccaagatacaagatctggttccagtattggataaatcactttcatgacaccaccatttaaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32817870 |
ggactagcattatccgcaaggccagcaatgacgttgttccaagatacaagatctggttccagtattggataaatcactttcacgacaccaccatttaaac |
32817771 |
T |
 |
| Q |
201 |
cttgtttagcatgtcccaaatgaaggtgttccatgaagtagaacttaaatgggatttcatagaaaactgaaaactcatgtgatgt |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32817770 |
cttgtttagcatgtcccaaatgaaggtgttccatgaagtagaacttaaatgggatttcatagaaaactgaaaactcatgtgatgt |
32817686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 103 - 241
Target Start/End: Complemental strand, 32815901 - 32815762
Alignment:
| Q |
103 |
actagcattatccgcaaggccagcaatgacgttgttccaagatacaagatctggttccagtattggataaatcactttcatgacaccaccatttaaacct |
202 |
Q |
| |
|
|||||||||||| |||| |||||||||| | ||||||||||||||| ||| |||||| | ||| || || || |||||| || || || | |||||| |
|
|
| T |
32815901 |
actagcattatctacaagaccagcaatgatgctgttccaagatacaatatccggttccggcattttatcaaacagtttcatcgcatcatcaatcaaacct |
32815802 |
T |
 |
| Q |
203 |
tgtttagcatgtccc-aaatgaaggtgttccatgaagtag |
241 |
Q |
| |
|
||||| |||| ||| |||||| |||||||||||||||| |
|
|
| T |
32815801 |
tgttttgcataccccaaaatgagtgtgttccatgaagtag |
32815762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University