View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8602_high_7 (Length: 228)
Name: NF8602_high_7
Description: NF8602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8602_high_7 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 7 - 228
Target Start/End: Original strand, 56442487 - 56442708
Alignment:
| Q |
7 |
gtgtggggtccatcccttttccttaacagaagaagatgatagttctagagaggatagaaatgcgtgtgagagaaatggattgaatttgtctggtcctcct |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
56442487 |
gtgtggggtccatcccttttccttaacagaagaagatgatagttctagagaggatagaaaagcgtgtgagagaaatggattgaacttgtctggtcctcca |
56442586 |
T |
 |
| Q |
107 |
gtagcatcaagagcacatgcatcccattgggtggatggaatatctgaaattgaagatacaaaagaaacagtaataatcttatctttatcttcttcagatt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
56442587 |
gtagcatcaagagcacatgcatcccattgggtggatggaatatctgaaattgaagatacaaaagaaacagtaataattttatctttatcttcttcagatt |
56442686 |
T |
 |
| Q |
207 |
ctgttgtggtggtcacattgaa |
228 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
56442687 |
ctgttgtggtggtaacattgaa |
56442708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University