View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8602_low_6 (Length: 239)
Name: NF8602_low_6
Description: NF8602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8602_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 120
Target Start/End: Original strand, 56442875 - 56442989
Alignment:
| Q |
1 |
aacgacaatgagcagcagcatctcactcctatcgctgctgctgccatcacccctcactccttgccacgttgcagatttacttggattggattggattgga |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| ||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
56442875 |
aacgacaatgagcagcagcacctcactcctatcgctactgctgccatcacccctcactctttgccacgttgcaaatttac-----ttggattggattgga |
56442969 |
T |
|
| Q |
101 |
ttcatgcattgcatacttca |
120 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
56442970 |
ttcatgcattgcatacttca |
56442989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University