View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8602_low_7 (Length: 237)
Name: NF8602_low_7
Description: NF8602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8602_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 5 - 221
Target Start/End: Complemental strand, 13468256 - 13468040
Alignment:
| Q |
5 |
tatatttgggctttgtaaggtccattttaggcatccctgtcttttaactaaaagaaattgctctttaggcttccatattgttcacagaccccttaaagtt |
104 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13468256 |
tatatttgggctttgtaaggtccattttatgcgtccttgtcttttaactaaaagaaattgctctttaggcttccatattgttcacagaccccttaaagtt |
13468157 |
T |
|
| Q |
105 |
tcgaaaatgttcctctacataaccatggaaagttatgttcaaatgctctcgggagttatgttctgatactctaggaagttatcttcagatgcctcgtcaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
13468156 |
tcgaaaatgttcctctacataaccatcgaaagttatgttcaaatgctctcgggagttatgttctgatactctaggaagttatcttctgatgcctcatcaa |
13468057 |
T |
|
| Q |
205 |
atatactagctaggttt |
221 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
13468056 |
atatactagctaggttt |
13468040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University