View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8603_high_12 (Length: 261)
Name: NF8603_high_12
Description: NF8603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8603_high_12 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 15 - 261
Target Start/End: Complemental strand, 37047643 - 37047405
Alignment:
| Q |
15 |
cagagaatgagaaaactgttattgtttacatattgatattgtttgcattattctttctactacatatagacgcacatctaaattgttaatagtatatgtt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37047643 |
cagagaatgagaaaactgttattgtttacatattgatattgtttgcattattctttctactacatatagacgcacatctaaattgttaata-------tt |
37047551 |
T |
 |
| Q |
115 |
cagtcgattttttgtcnnnnnnnnntgttcagtttatttcttatgataatatatcagctgccatgttttctaatgtaaaatcatgtcataatagtatagt |
214 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37047550 |
cagtcgattttttgtcaaaaaaaa-tgttcagtttatttcttatgataatatatcagctgccatgttttctaatgtaaaataatgtcataatagtatagt |
37047452 |
T |
 |
| Q |
215 |
agcttttattcttaactgaattggatactaaatatttgcagacccaa |
261 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37047451 |
agcttttattcttaactgatttggatactaaatatttgcagacccaa |
37047405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University